display | more...

An enzyme used in molecular biology. When DNA Polymerase I from E. coli is cleaved by the protease subtilisin, the Klenow Fragment is the larger fragment. It still has the polymerase activity (the ability to add new dNTP's, or nucleotides, to a DNA strand) and the 3'->5' exonuclease activity. However, it lacks the 5'->3' exonuclease activity. The klenow fragment can also be expressed in bacteria from a shortened, cloned version of the polymerase gene.

To clarify how its exonuclease activity works, take this strand of DNA for example.

5'   ATGCGTACGCTACCATCACGGCT   3'
3'       CATGCGATGGTAGTG       5'

Because the Klenow fragment has 3'->5' exonuclease activity, it will degrade (remove) the nucleotides hanging off the 3' end. Meanwhile, since it has lost the 5'->3' exonuclease activity, it cannot degrade the overhang on the other end. Taking this into account, the DNA fragment will look like this:

5'   ATGCGTACGCTACCATCAC       3'
3'       CATGCGATGGTAGTG       5'

But wait! Remember that it's a polymerase too, so it can add dNTP's (in other words, extend the strand by adding more nucleotides to one side). This polymerase activity only works in the 5'->3' direction, and it needs a double-stranded primer at the 5' end. So, it can fill in the gap that's left:

5'   ATGCGTACGCTACCATCAC       3'
3'   TACGCATGCGATGGTAGTG       5'

The klenow fragment has many uses in molecular biology. For instance, klenow fragment can be used to synthesize a second strand of DNA, starting from a single strand and a primer. The klenow fragment can also be used with dNTP's that are labeled (fluorescently or radioactively), so that the area that it fills in - typically from a recessed 3' end, or a nick - carries the label. For more uses, check out the references.


References:
http://arbl.cvmbs.colostate.edu/hbooks/genetics/biotech/enzymes/klenow.html
http://www.fermentas.com/catalog/modifyingenzymes/klenowfragment.htm

Log in or register to write something here or to contact authors.